mouse nox4 forward 50 cgggatttgctactgcctccat  (OriGene)

Journal: Cancer medicine

Article Title: Hypoxia and Hypoxia-Reoxygenation Potentiate Helicobacter pylori Infection and Gastric Epithelial Cell Proliferation.

doi: 10.1002/cam4.70860

Figure Lengend Snippet: FIGURE 3 | Hypoxia and HIF1α upregulate CEACAM6 and NOX4 in hypoxic GECs, gastritis as well as GC samples. (a) Immunofluorescence microscopy images showing enhanced ROS production in AGS cells under hypoxia. The mean fluorescence intensity (MFI) graph denoted the signif- icant difference in ROS generation between normoxia and hypoxia. Graphical data indicated mean ± SEM. Paired t-test was performed to determine statistical significance. n = 3, **p < 0.01. (b) Correlation analysis performed in GEPIA2 showed a positive Pearson correlation coefficient between HIF1α and NOX4 gene expression normalized to TUBA4A (p = 0, R = 0.64). (c) Box plot representation of NOX4 expression in STAD tumor and normal samples (red = tumor, gray = normal) showed a significant NOX4 upregulation in tumor samples (num[T] = 408, num[N] = 36, p value cutoff was 0.01). (d) Pathological stage plot showed a high association of NOX4 with the four stages of STAD tumor (F value = 5.67, Pr(>F) = 0.000832). (e) GEPIA2 correlation analysis showed a positive Pearson correlation coefficient between CEACAM6 and NOX4 (p = 7.3e-05, R = 0.19). (f) Immunofluorescence micrographs of human gastritis biopsy tissue sample showing the status of HIF1α (green), CEACAM6 (red), and NOX4 (red) (n = 3). (g) Human met- astatic GC biopsy tissue and their paired normal tissues (n = 3) showing enhanced expression of HIF1α (green), CEACAM6 (red), and NOX4 (red) in GC samples. Nuclei were stained for DAPI (blue). Graphical representation showing significant changes in the levels of HIF1α, CEACAM6, and NOX4 are present in Figure S3. Tissues were sectioned at 5 μm thickness. Images were captured using 20× objective and scale bars = 50 μm. In panel c, *indicates significance.

Article Snippet: Human CEACAM6- pdKCR- neo construct, pCMV6- Xl5- HIF1α (Origene Technologies, MD, USA), human NOX4 (courtesy: Karl- Heinz Krause, Addgene plasmid #69352) overexpression plasmids and empty vectors were used in this study [36, 37].

Techniques: Immunofluorescence, Microscopy, Fluorescence, Gene Expression, Expressing, Staining

Journal: Cancer medicine

Article Title: Hypoxia and Hypoxia-Reoxygenation Potentiate Helicobacter pylori Infection and Gastric Epithelial Cell Proliferation.

doi: 10.1002/cam4.70860

Figure Lengend Snippet: FIGURE 4 | CEACAM6 upregulates NOX4 and increases ROS production in hypoxic AGS cells. (a) A representative western blot showing sig- nificant upregulation of NOX4 in CEACAM6 stably expressing hypoxic AGS cells. (b) Immunofluorescence microscopy data showed elevated ROS production in CEACAM6-stably expressing AGS cells in hypoxia. Bar graphs of MFI indicated a significant elevation of hypoxia-mediated ROS generation in CEACAM6-overexpressed stable AGS cells. (c) Hypoxia-exposed, CEACAM6 siRNA transiently transfected AGS cells analyzed by western blotting showed significant suppression of NOX4 protein levels. (d) Representative immunofluorescence microscopy performed on control and CEACAM6 siRNA transiently transfected normoxic and hypoxic AGS cells and the MFI graph confirmed a significant reduction of hypoxia- mediated ROS generation with the suppression of CEACAM6. In both b and d, nuclei were stained with DAPI. n = 3, Objective used 60×, scale bars represented 25 μm. All graphical data represented mean ± SEM. Two-way ANOVA was performed and the results were corrected for multiple com- parisons using Tukey's post hoc analysis. n = 3, *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: Human CEACAM6- pdKCR- neo construct, pCMV6- Xl5- HIF1α (Origene Technologies, MD, USA), human NOX4 (courtesy: Karl- Heinz Krause, Addgene plasmid #69352) overexpression plasmids and empty vectors were used in this study [36, 37].

Techniques: Western Blot, Stable Transfection, Expressing, Immunofluorescence, Microscopy, Transfection, Control, Staining

Journal: Cancer medicine

Article Title: Hypoxia and Hypoxia-Reoxygenation Potentiate Helicobacter pylori Infection and Gastric Epithelial Cell Proliferation.

doi: 10.1002/cam4.70860

Figure Lengend Snippet: FIGURE 5 | Hypoxia and hypoxia-reoxygenation of GECs promote H. pylori infection. (a) CagA translocation, CEACAM6 and NOX4 protein lev- els in AGS cells increased in the presence of hypoxia and H. pylori (mentioned as Hp in the Figure) (graphical data can be found in Figure S6a–c). (b) Confocal imaging data revealed that H. pylori infection of AGS cells was increased in the presence of hypoxia. H. pylori = green, CEACAM6 = red. Nuclei were stained for DAPI. Objective used 63×, scale bar = 20 μm. (c) AGS cells were either kept in hypoxia or normoxia for 12 h followed by H. py- lori (50 MOI) infection for 12 h or cells were left uninfected in normoxic condition. Bright field imaging (n = 3) revealed that hypoxia-reoxygenated infected cells showed significantly increased hummingbird formation. Objective used 40×, scale bar = 25 μm. (d) Graphical representation of changes in proliferation of the same experimental sets of cells as mentioned in panel c and assessed by the MTT assay. The result showed significantly en- hanced proliferation in hypoxia-reoxygenated H. pylori-infected cells as compared to the normoxia-exposed infected cells. (e) A representative west- ern blot (n = 3) of whole cell lysates from the same experimental sets showed a significant increase (graphical data shown in Figure S6d,e) in CagA translocation as well as CEACAM6 level in hypoxia-reoxygenated infected cells as compared to the cells kept in normoxia before the infection. For all graphs = mean ± SEM. One-way ANOVA was performed to assess the statistical significance between the different groups, n = 3, *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. In the Figure, Hp = H. pylori.

Article Snippet: Human CEACAM6- pdKCR- neo construct, pCMV6- Xl5- HIF1α (Origene Technologies, MD, USA), human NOX4 (courtesy: Karl- Heinz Krause, Addgene plasmid #69352) overexpression plasmids and empty vectors were used in this study [36, 37].

Techniques: Infection, Translocation Assay, Imaging, Staining, MTT Assay

Journal: Cancer medicine

Article Title: Hypoxia and Hypoxia-Reoxygenation Potentiate Helicobacter pylori Infection and Gastric Epithelial Cell Proliferation.

doi: 10.1002/cam4.70860

Figure Lengend Snippet: FIGURE 7 | CEACAM6-expressing GECs activate the CEACAM6-NOX4 cascade, upregulate ROS generation, and gain significantly more prolif- erative ability after being exposed to hypoxia-reoxygenation and H. pylori infection. (a) Western blot analysis showed that levels of CagA, CEACAM6, and NOX4 were significantly increased (graphical representations are shown in Figure S7a–c) in AGS cells upon CEACAM6 stable overexpres- sion and hypoxia-reoxygenation before infection with H. pylori. (b) Fluorescence micrographs and graphical data (n = 3) demonstrated enhanced ROS production in hypoxia and reoxygenation-exposed and H. pylori-infected CEACAM6 overexpressing AGS cells when compared with the empty vector-expressing stable cells with similar treatments. For ROS detection, cells were incubated with 1 μM DCFDA for 1 h after infection. Nuclei were stained with DAPI. (c) Graphical representation of cellular proliferation assessed by MTT assay (n = 3) showed significantly increased proliferation of H. pylori-infected cells with CEACAM6 overexpression as well as hypoxia-reoxygenation when compared with the empty vector-expressing as well as normoxia-exposed cells. Objective used—60×, scale bars representing 25 μm. Graphs = mean ± SEM. Statistical significance was determined using two-way ANOVA followed by Tukey's post hoc analysis (n = 3). *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. In the Figure, Hp = H. pylori. (d) The summary figure depicting the regulation of ROS signaling events in H. pylori-infected normoxic and hypoxic GECs. H. pylori infection of GECs leads to the accumulation of HIF1α in normoxia, but the effect is far more enhanced in hypoxic cells due to the increased level of HIF1 and HIF1-driven CEACAM6 upregulation. CEACAM6 facilitates H. pylori adhesion and upregulates ROS via enhanced NOX4 generation. Enhanced HIF1-CEACAM6-NOX4 signaling has a proliferative effect on GECs. Numbers indicate the sequence of events.

Article Snippet: Human CEACAM6- pdKCR- neo construct, pCMV6- Xl5- HIF1α (Origene Technologies, MD, USA), human NOX4 (courtesy: Karl- Heinz Krause, Addgene plasmid #69352) overexpression plasmids and empty vectors were used in this study [36, 37].

Techniques: Expressing, Infection, Western Blot, Fluorescence, Plasmid Preparation, Incubation, Staining, MTT Assay, Over Expression, Sequencing

Journal: Cancer Medicine

Article Title: Hypoxia and Hypoxia‐Reoxygenation Potentiate Helicobacter pylori Infection and Gastric Epithelial Cell Proliferation

doi: 10.1002/cam4.70860

Figure Lengend Snippet: CEACAM6 ‐expressing GECs activate the CEACAM6‐NOX4 cascade, upregulate ROS generation, and gain significantly more proliferative ability after being exposed to hypoxia‐reoxygenation and H. pylori infection. (a) Western blot analysis showed that levels of CagA, CEACAM6, and NOX4 were significantly increased (graphical representations are shown in Figure ) in AGS cells upon CEACAM6 stable overexpression and hypoxia‐reoxygenation before infection with H. pylori . (b) Fluorescence micrographs and graphical data ( n = 3) demonstrated enhanced ROS production in hypoxia and reoxygenation‐exposed and H. pylori ‐infected CEACAM6 overexpressing AGS cells when compared with the empty vector‐expressing stable cells with similar treatments. For ROS detection, cells were incubated with 1 μM DCFDA for 1 h after infection. Nuclei were stained with DAPI. (c) Graphical representation of cellular proliferation assessed by MTT assay ( n = 3) showed significantly increased proliferation of H. pylori ‐infected cells with CEACAM6 overexpression as well as hypoxia‐reoxygenation when compared with the empty vector‐expressing as well as normoxia‐exposed cells. Objective used—60×, scale bars representing 25 μm. Graphs = mean ± SEM. Statistical significance was determined using two‐way ANOVA followed by Tukey's post hoc analysis ( n = 3). * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001. In the Figure, Hp = H. pylori . (d) The summary figure depicting the regulation of ROS signaling events in H. pylori ‐ infected normoxic and hypoxic GECs. H. pylori infection of GECs leads to the accumulation of HIF1α in normoxia, but the effect is far more enhanced in hypoxic cells due to the increased level of HIF1 and HIF1‐driven CEACAM6 upregulation. CEACAM6 facilitates H. pylori adhesion and upregulates ROS via enhanced NOX4 generation. Enhanced HIF1‐CEACAM6‐NOX4 signaling has a proliferative effect on GECs. Numbers indicate the sequence of events.

Article Snippet: Human CEACAM6 ‐pdKCR‐neo construct, pCMV6‐Xl5‐ HIF1α (Origene Technologies, MD, USA), human NOX4 (courtesy: Karl‐Heinz Krause, Addgene plasmid #69352) overexpression plasmids and empty vectors were used in this study [ , ].

Techniques: Expressing, Infection, Western Blot, Over Expression, Fluorescence, Plasmid Preparation, Incubation, Staining, MTT Assay, Sequencing